Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhhg4b05
Contig Information
Length 901 bp
Tissue Anther at meiosis of MT4B CS wheat
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhhg4b05   
Homology (BLAST) Top Hit Os02g0773400 [Oryza sativa (japonica cultivar-group)] >gi|46805376|dbj|BAD16877.1| putative cyclic nucleotide-binding transporter 1 [Oryza sativa Japonica Group] >gi|113537799|dbj|BAF10182.1| Os02g0773400 [Oryza sativa (japonica cultivar-group)]
Score 1001
Evalue 1.02938e-106
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>rwhhg4b05
TCAAGAGATTAGTTTCACACATTTGGAAGTACAAGATCAGAGAACCGAAGAGTTGTGTCCCGCACGGATTTCAGGATTTCTAGCAGTTGGAGATGGACAA
CTGTTAACCAATAGTTAGTACTACCTACTTAGGCAGAGTATCACCCCCTCTGTCCAGGCTGAAAAGCATACTGAGAACATGTACCCGGTATACGATCGGG
TTCTTCGCTTGGCCTTGATCTTTCAGCTCGCTTTAGTCGTCTCTTACGATACCTCCACGCGACTTGGATGCGCGCTGCAGCGATGGTCCTCCAGTAGGGT
GATTCATACCTGATAGCCCCCTGCACTCTTGGATTACGCAAGAACCGTGCAAATTGTCCAGTAACTTGTTCGAGATCACTTGCTCGAAGTACAAAAGCTT
CAACATTCGTTAAGCATCGCACAGTACGTATAGCAACCAAACGCATACCATGAAATCTACTTTTCCCGCCATCTTTATTCGTTGAAGAGTGTTCCAAGTA
CCATGTGAGGAGTTCCTCTCCACATACATCTCCATCTTGTAACGGAGCCCTGCTTCCATCTGCACTGATGCTTTCTAGCTTGCCTCTCACTATGAAGATC
ATCTTGTCAACAGGGCCACCTTGATAAAGAATGTCACTTCCACTGATATATAAGTTTTGTCTTAATTTGTCACAGATAGCATCCAAGATAGGCCAATCCA
TCAAGGTGAACAATCGAACCTTATTAAGGAATCTAAAGAAATGTCGACGTATATCCCTTTGAATATCTTCTGGTAAATTACTTAAGAGCTCCTCTTCATT
TACTCCTTGAGTGGCTGCCCAGGTGAACCTTTCTGCATGTCTAACCCTCCTTCTCAAATCTTCAGGCAGTCGTCTATGGCTCATCCACTGCTCAACGTCA
C
page-top