Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whhg2k16
Contig Information
Length 745 bp
Tissue Anther at meiosis of MT4B CS wheat
Clones 1 Clones [Download: CSV  ,  FASTA ]
whhg2k16   
Homology (BLAST) Top Hit hypothetical protein OsI_09257 [Oryza sativa Indica Group]
Score 163
Evalue 1.08472e-09
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>whhg2k16
GAGAGGAAAGGGGATCGGGTGTCAGTAATGCGCCGCCGCCTGCCGTGCGCCGATCTCCACTCTCTCGCCGTCACCGTCGCCGTCGGATGCCTCGAATGAG
GATCCACCGGTGCTTGAGCAGAGTCGACCAAATAAGCAGCTCCCAAAGTGGGAGCTGCAGCCCCCAATCGAAGCAGCAGCAGCAGCAACTCCTTTTCGAG
CTGCGGTTCGCAATCGAAGCGGCAGTCCGGAATCAAAGCAGTCCTTCCCGGGCTACAATCAGAATCAGCAGTTATATATATCTGGCCTGGCGGCACCCTC
CAATATTCGGAGAAGACGCAGCAGCAACTCCTTAGACATCAGTTTTTAGACTGACCGGCGGCAACTTGGGCGATGGCGAGGACTAGTAGCCGGCGACGGG
CTGCCAAATTGATGGCCAAGCCATCCGGTTCGACCATGGTGAAAGGCAATCCAGATGATAGGATCAGCAGCTTGCCCAATGACATCCTGGTCAACATTCT
CGACCGGCTCGATGTTCGCGCCGCTACGAGAACCAGTGTCCTCTCGAGACGGTGGAGTCAGCTTCCTGCCATGGTCCCACGGCTTACAATCAGTGCTCGG
GACCTCCTGCCGTCAGAAACTAAAACCAGCATTTCCAAAGCTGAAATTGTTCGGAGGACCACTGCAGCTGTGGCCAAAGATCCGGCCAATGTAGCAGTGT
CCGATGCTGAATTTGTTCGGAGGACCANTGCAGCTGTTGCCAAAG
page-top