Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhhg8f11
Contig Information
Length 754 bp
Tissue Anther at meiosis of MT4B CS wheat
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhhg8f11   
Homology (BLAST) Top Hit hypothetical protein OsI_03221 [Oryza sativa Indica Group]
Score 510
Evalue 6.44846e-50
Total Hit Count 66
Registered year 2003
Contig Sequence     [ Download ]
>rwhhg8f11
TGCATTCTATAGTATGTAACAGCTGTGTGATGTTGGTACAGACCAATGTTCCTTGACAATGAAGAGGATGGCACAACAAGTTACAACCAAGGCAAGGAAC
TGCTGGGCGATAATTCGGTGGAAAAAACGGCAATATGGAACAGCTACCATAAATTAAGGTGTATGTGTCAAGTCCAAATAAAATCCGCACTTGACTACGG
GTGCACCAGACGCACTTGCCTTCGCCCAAGTTAAGACTAACCACTCATGGCGGAGTGCTGCTGTTCTATCCGAATCAGCGTGAAGGAAGCACCCATCTAA
CAAGGAAAATGCAGGGCCATTCGAGCACTCAGTCGTCTCCAAATAAAGTGGAGAGGACCAGGTCTTGCACAAAGGTCGCCCTGCTTGTGGCTTGTTTCCG
CTTTTGTTCCCTTTCCTCGCTTGTGAGGGACGAGTCAATGCTTGATTCCCAAGGTTGAGGAGGCGCCTCCTTAAGAATTGAAGTATCATCGAGAACCGGA
ACTGATGATTTCGATGGTTCTTCGGCATCTGATGTTGCAAAACCCAGGCCAAACGATGAAAGCAGTGGATCAGCATAGATATTTGTAGTGGCAGTGGTGG
TGTTCCTTGACCTATGACTATGACCGCCTCCTANAAGCGCCTGCAAATGAGCATCACGTANATCTCGGCTCANTAAAGAAAGTGCACAGCGCTCGGGAAT
AACGAATCTGCGCAACCGGCTGCCATTCTTGAACAAGTAACCATGATGCATGGT
page-top