Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhhg4b14
Contig Information
Length 791 bp
Tissue Anther at meiosis of MT4B CS wheat
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhhg4b14   
Homology (BLAST) Top Hit hypothetical protein LOC100191944 [Zea mays] >gi|194690248|gb|ACF79208.1| unknown [Zea mays]
Score 706
Evalue 1.32948e-72
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>rwhhg4b14
CTCGCTTCATTGAATGGAGCAGGGGCTGTGATGCTATATAATTAAAAGGAACTTTTATCACCCAGCAACATGCATATATATATATATCCTAAATGAAACT
TTGTTATTACTATCTACTGCTACAAAGAAATCAACATCAGAGCACTTCTCCCTGTATAATGGTGAACACGCACTTTAAGAAAAAGAAAATGTAGAGCACA
GCTTTTACATTCGATGTACTTGAGGGAAGCCATGAAAGAGACGGCTGGATACAGAAGCACATCGTTCTTCTCCAGGGAGCTCATGAGCTCTGGCCCTCCT
GCAGCTGTTGCTGCTGCTGCTGCTGCTGCAAGTTGACGAGCTTGTGGTAGGCACCATTCTTGTTTTCGATGAGGTGCTGGTGATCCCCCTGCTCGATGAT
CTTGCCGTCCTGGATCACCGAGATGACGTCGGCGTTCTTGATCGTTGACAGCCGGTGCGCCACCATCACAGTGGTCCGGTTCTTCATCACCCTGTCCAGA
GCCTGCTGCACCACGCGCTCCGACTCCATGTCCAGCGCGCTCGTTGCCTCGTCCAGGAGCAGGATGGCCGGGTCCTTGACGATGGCGCGTGCGATGGCGA
TGCGCTGCTTCTGCCCACCCGACAGCTGCACGCCGCGCTCCCCGACCTTGGTCTGGTACCCCTCCGGCAGTGAGCTGATGAAGGTGTGCGCGTTCGCCAG
CTTCGCCGCCTCGATGACCTCGGCCTCCGTCGCGCCGTCCTTGCCGTAGAGGATGTTTTCGTAGATCGNCGTCGCGAACAGCGCCGGCTCT
page-top