Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhhg4b19
Contig Information
Length 853 bp
Tissue Anther at meiosis of MT4B CS wheat
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhhg4b19   
Homology (BLAST) Top Hit RecName: Full=Pectate lyase; Short=PL; Flags: Precursor >gi|623540|gb|AAB46399.1| pectate lyase >gi|1246871|gb|AAA93535.1| pectate lyase
Score 87
Evalue 0.90699
Total Hit Count 1
Registered year 2003
Contig Sequence     [ Download ]
>rwhhg4b19
CATTACATAAGCTACCATGATCATCCTGCATTGCATACATAAGTTTGCATCCATCCCCTTCATCTTCTAAACGAACAGGGTGCAGGCAGTAGAACAACAA
AAGTCTATCATAGACACCAACGTAAGTATTGTGTTTCCGTGGACAACATAACAACATCAGCCAACCAAAAGTGCCAAATACAGAAATAAATGTATGCCAA
CCAACATGACATGACATAATCAGAGCCACCAGAGAAACCAGACACTGTTGTAGACCATCCGAAGCTACGCCTCCATAGCCAAAGATCACTCCTATGAGCA
TCGATATTGGCCAGGGGCAGGGCCATCACCACTCAACGCTTCAAACCCTTTTGCGGTAGTGAAGCAGGGAGGCTGACATGGAGGCCGAGGAAGCCATAGA
GGCAGTTATAGATGACGCCGTGTATGTCGATCGTCCACTCAACCTCCCTCTCCACCAACACCTCTTGCAATGACTCTCGGAGGCCAAATGTGCCTCAATG
GCAGCTCCACCCTCATCAGCATGGTCACGAAAACAAAGATAATTGCCCGCACATCTTATTGCCACCTTTATTGTGCCTCATACCTAGCTGAAGTTCCTGA
TAATTGTTTGCTAGAAACCATCTTGTTATCCTGAATACATGGTCGACGACGGCATTGTTCCTCGAATTCAGTGTGCTCCAACCACTGGCCACACACACTG
CTGACCAAACCCTACAACCTGGTCAATCTGGCAGGATTGGCCATGCCCAAGGAGGTCGTGGATGCTGCAACTGGCTCTGCTCTGACGCCCCACCTTCTCC
AACTCCACCCTCACAAGAATTGNAATACTTGAAAGTCATGCCAACCACAAGCT
page-top