Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhhg4b21
Contig Information
Length 850 bp
Tissue Anther at meiosis of MT4B CS wheat
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhhg4b21   
Homology (BLAST) Top Hit fructan 1-exohydrolase w1 precursor [Triticum aestivum] >gi|206598524|gb|ACI16115.1| fructan 1-exohydrolase w1 [Triticum aestivum]
Score 1043
Evalue 5.28066e-113
Total Hit Count 494
Registered year 2003
Contig Sequence     [ Download ]
>rwhhg4b21
TAGTGTGCGTTTCTTTAAAAATTGATACAAGTAACTGAGATGGGAAGGGCATACTAAGTAGTAACTAGTACAATATATGAATACTAGAGATCAAAGAAAT
GATAGGCTATTTTTTCCTGCTGAATGTCCTTATTTCTGCCAGGCAATGCTCATGAATGACAGTAAAAGAATCGAGAAAATCAATTTGATCCTCTCTTTTA
AATAGCACTCCAGCCCTTCTCCACATTCACTTGTGCCTTCCTCATGGTCCATGCGCTGAGCTGTGGCACCCTGACCGTGGCACTTCCATTGTTGAAAGCG
TAAATGTGGGCCCTGCCGACGTCGGCGAGCACCGCCGGATAAACTCTGGATGTGATGCAAACCCTGCCACCGCCGCCGAAGCTCTCCACCGCCGACCGGT
CAATCAGAGTTCTGAGTGATATCTTCCTTTCCTTTTCAAGATCAAATTCAAAGAAGCCTCCATAGGCTGGTTTCTCCAGATCTGGTCTCAGGGAAGACCT
TCTTAGATCAGAGCACATGAGTACCATGTACTTTTCCTGTGACTTGTAGACTCTGAAATACACCTCAGTGTGCTCGTCCATGTTGTCGGAGGCCAGAATG
ACAAGTCCAAATGGACCTATACCACCAGGAACTGATGCACCCGCTTCCCCACAATGCTTCTCGGGGTCCAAAAGCCAGGAAGGATCAAAAGGATCGGCGT
CATCGATGGACGCCAGCTCGAAACCTATCTCTACATCAGCCTGAAAAGCGTCAACTTCCTTGATCTCAAATAGATCTCCCTTGTTGAGCTCTATTCCTTG
AATGGCTGATTTCATTTGGTTCGAAGGGACTCAATCTCCTCAACTGGCCA
page-top