Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whhg2j05
Contig Information
Length 437 bp
Tissue Anther at meiosis of MT4B CS wheat
Clones 1 Clones [Download: CSV  ,  FASTA ]
whhg2j05   
Homology (BLAST) Top Hit ferredoxin [Zea mays]
Score 285
Evalue 2.66156e-24
Total Hit Count 115
Registered year 2003
Contig Sequence     [ Download ]
>whhg2j05
CATCGCGCAGGAGTGGCTCGAGAAGATGCCCGCGGCCTCCTACGAGGAGCGCTACGTCCTCACGCGCGCCTCCCGCAACCGGGAGCTCAACAAGCACGCC
CGCCTCGGCTGCCAGGTCGTGCTCGGCAAGGAGCACCAGGGGATGGTCGTCGCCCTCCCCGAGCCCAAGCCCTGGGACATCCCGTAATGCGGCCCGCCTC
CGCGAGGCGAGGCGAGGCGAAATTGTGCGGCCCTTCGACGCCGCGAGCCTTCCTTCCTCGCCCCTTCCGGTCCTTTCATGGTACGGATTTGATGAAAGAA
TAATGAATTTGATGGGCAAAACTTAGAGCTGTTTCTGAAACTTTTATTTTGTTTGAATGTGGATGATGTACCAGAGTTTAGCAATGGCGGCTGGGCGAGC
GTGTGCTCTTAGCGTGGTGCTGTTGGTGGTGGTGGCG
page-top