Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhhg8h20
Contig Information
Length 740 bp
Tissue Anther at meiosis of MT4B CS wheat
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhhg8h20   
Homology (BLAST) Top Hit hypothetical protein OsJ_007758 [Oryza sativa (japonica cultivar-group)]
Score 743
Evalue 6.00834e-77
Total Hit Count 156
Registered year 2003
Contig Sequence     [ Download ]
>rwhhg8h20
ACGACAAGTATCATCGTATGCAAATAAACAAGCGACCCAATCCCTAACTGAATGTACGTGCAGTGCAGTCTTCTACCGGATGAATACAGACATCGTTCAG
CAGTATAAAAGGCAGCAGACATGCTGTGTATCCCTAATGGAACTCCGCAACTTGCTGGGCCGGTATTTAGAAGTTGATTAGGTCATCCTTCTTTGGGTCC
TGCCTTTTGGACACGTCCTGGGAACTGCTTCCTCCCTTCTTGCCAAATATCATCTCATCGAGATCATCGAGGATATCATCATCGCCGCCTGACATTGCTC
TAGCAGCAGCTGGTTTTCTGACCAGGGCATCCTCATGGCCAACAGTCACGGAATCTTCATGCTCCGTGGCAATTGGTATGACCACTGGCTGTTCTGTACG
CGCCGAAGCCATGGGCTTCTTCATCTCTTCGTATTTGGATAGCACTTTCAGGACTTCATCATTCACACTCAAGGCCTCGAAGAGCAAGGCCTCATTGTCC
CCAGCCGTCTCGATGAATCTCTGGATAGTATGTTGAGATTGGTAGCATTGTTGCACAAGAGTGGTTGTTAAGTCATCCTGCAAAGCATCCTGCTGAGGGG
AGGATGAAAGAACAGTTGAAAGAAGTTCCATGCTGTTACGGGCCACATCGAAAGCTTCCTTTGTTTCTTCAGCAGTATATGTATGCACATGTACATCTTC
NAATATCTGCTGGGAGAAATTTNGCAGCAACTTCAGCTTC
page-top