Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhhg4n11
Contig Information
Length 876 bp
Tissue Anther at meiosis of MT4B CS wheat
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhhg4n11   
Homology (BLAST) Top Hit PREDICTED: hypothetical protein [Rattus norvegicus]
Score 79
Evalue 8.04935
Total Hit Count 1
Registered year 2003
Contig Sequence     [ Download ]
>rwhhg4n11
GCACAGATAGCAGCAGATAAGCTCTGTTTATTCAACAATACATTGTCAACTTGGAAATATCCAGCAGAATTTAAGCGAGGACCATGACATACAGGCACAT
TGCCTAGGCATGATGCAAGAGCTAGACTGCGTAGCACAATGCAGCTGAATGCACATTATTGACAGACCAATATCCAGTTCACGACCAGTAGCCAAAAGCC
CCAGCGACTACTAGGCATGATGCAAGAGGAAGGTTGCATATGCATAGCACAATGCAGCTCACTGCACATTATTGACACTCTCATATCCAGTTCACCCTCT
AATGGTTGAAAGCCCTAGCGACTACTACTACGCATCGACAGTTCAGAGCTCAAGTTGGACGACCGACTTCTGATTGACACCTCAACACGACACACGACCA
AGCTGGAAAACTTGTGTGCACGAACAGTGCAGACTCACAACCAGTAAGTAACAGGGTTAAAATGTCCTGTGAGAAATAGCTAACGACACCACAAAGAAAC
GAAAGGAACTATGATGTCAAGAACTAAAAGACCACGGCTAGACCAATAACAGGCACCTAGCAATGTACACCGCCGTGTGCCTGAAACAGTAACAGGACGT
TTGCCCTGAGTTAACCACACTAGTGTCAGCATAACAACGTCAATCAGAACACCCAGATGTCTTGTCTCACACATGATCCACTAATGTTCCCATATACCAC
AGGAGGCCCACGATAAGACCTGACAGGTGATGAGATGGTATTTACAAGAGTTGTCTTCTTATTACTCAGAGAAAGTGAATGCATGAGAGCACTATCCTAT
CATTGGCAATATATGGCCTGGTCTATCTGAGGGGGGAATTGGTTTTTATCTCAGTCCCAAGCTCCCTGCTCAATCC
page-top