Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhhg10k02
Contig Information
Length 853 bp
Tissue Anther at meiosis of MT4B CS wheat
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhhg10k02   
Homology (BLAST) Top Hit alliin lyase 2 precursor [Zea mays]
Score 741
Evalue 1.32425e-76
Total Hit Count 95
Registered year 2003
Contig Sequence     [ Download ]
>rwhhg10k02
TATTCTGGTTTTCGGTATTTGTACTGTGTTATTTTTTCCAACCTCTCTTTCGGAATAAATAGCATCTCAGGTTGTTTCATAAGTAAAGAAACCTAGAAAA
ATGAAATTATTTAGCTGGATCACTAAGCTGGGTATTCGGAAACAAAACTCATCGATCGATCCCTAACCAGGGAGAGAAGCTAAGAGAAACAACACATCCT
TCACTGGCCATAGAAACAAACACATTATTCACTTATCCGGTGTCCTCATTTTATGGTGGCAAGGCGATTGACGAATATGCCGAATGCTTCATCAGTGTCG
ACCATACTGATCCTGACCACCTTTTGATCAGCTCCGAACTTAGTCCCGCTGCGGGTTATGATCTTGTTCTCACGCAAGAAGCTCTCTAGGTCTTCCACTT
CTTGCTTCTCACAGCGCAGCCATGCGAATGCAGGATTAGAGGTGACAGTGTCCTTGGTGAAGGTGCAGAAGCCGGCCACCTCGTTGGGGAGGCTAAAGAT
GCCGGAGGCTGCTACGGCAGCACGGAGTGCACACCAGCGGTGCGCCATCTTCCGCCGCGCGTAATGGAAGAGGAGGTTCGCGTCCCCACCGGCAGCGGCG
GCAAGCTGGTGCTCGTAGCCATCGGTGACCGCCCCGAGTACCTTGGCGGCGCGTAGCTGCGCGTCCTTGGACACGCCTATGGTGCTTTGCTCCATGAACT
TGCTCATTTTCTGTGCCACCTCCTTGTCCTTCACCAACGCCCACCCTATCCTCGTGCCGGCGTGGCCCGTACACTTTGACACGGTGAAGAGCATGATGTC
ATGGGCGAGCATGTGGGTGATGGGAGTGTACTGCGGCCAGTAGTAAGCCAGGT
page-top