Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhhg7o15
Contig Information
Length 878 bp
Tissue Anther at meiosis of MT4B CS wheat
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhhg7o15   
Homology (BLAST) Top Hit hypothetical protein [Zea mays]
Score 195
Evalue 2.84965e-13
Total Hit Count 186
Registered year 2003
Contig Sequence     [ Download ]
>rwhhg7o15
CACCATATCCATACTACTTGAGGAAGTAAATAATCAAATGACAATCACATGGGAGTTGTAGTTTCCACTTTACAATCCGAACAAAACTATATAGCTGATC
TCCAGGTAATTACATGACACGACAATGGCTTCGACAAATATCCATCTTTTATGGCATAAACACATCTATATATATATTGATTACAGTCAGTAATGAGAAG
TGATGGTAGCTCACTATGTAAAGATGTGTTATGGCCTGTGAAAATGGAATAGTGTTATGTCACACTATTTGGCTATTGCTATAGAAAAGCTGTTTTTAGC
AACCAGACTCCCTTCATTTAACAAAGGAGAGGTGGGGGCATGGTCATGGGATTTGGGCTCAGGAGCAGTAGGGCTGAATGGTGCTGTGGGCAAAAATCCA
TTGTCTACTTCTCTTGAAGCTAACATCTACCCTTTCCCAAGGAATTCTATTCAGGCTTTTGAGCGTTACTTTTGTTCTAGAGGCAACATTTGAGGACTGA
TACCTCCCTTATGTTCCATTTGAGCAATAGTGCACGCAATTCTTAGTTCCCTTATCATCGCATCCAAGAAAAGGCAAGTCAAACAAGAAACTGGAAAATG
TCGGTAAATGGCAAATTTAAGATTATCACTTCAGAGTCTTCTTGCCAAGATTTGCTGTATCATTGCTCGAGGTAGATCATCTGTCCAATGAAGCCCAAGA
CACCTCATTATTAAATCCTGGGAGCTTCAGAAACCAAGGGGAATAACACGGGACGGGGCTCATCCACCTGAGTTGTTCTAAAGGCAACATTCGAGGACTG
ATGCCTCATTATTAAATCCTGGGAGCTTCAGAAAACCAAGGGGGAAATAAACACGGGACGGGGGCTCATCCNCCTGAG
page-top