Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhhg4e01
Contig Information
Length 243 bp
Tissue Anther at meiosis of MT4B CS wheat
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhhg4e01   
Homology (BLAST) Top Hit hypothetical protein OsI_15662 [Oryza sativa Indica Group] (no hit)
Score 752
Evalue 5.5029e-78
Total Hit Count 0
Registered year 2003
Contig Sequence     [ Download ]
>rwhhg4e01
AATTATTTTTGAATATAGGGGGGTGGAGCACCCGAGTGCTCCTAATCCGCTTCCCGAGTGTATGCACGTATGTATGAGCACTTGCGTCTGTACTGATGTT
CAAAAAAAATAAAAAAGAAAATGGTTGGAGCTGTCACCAAATCTTGCATGTGAAACGCAAGTGAATCTGGGATTCCGCGAATCATACGAATCCTCGACCA
TTCTCAGGATATATACACATCTAAGGGAAAGAAGAAGAAAAAC
page-top