Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhhg10k24
Contig Information
Length 818 bp
Tissue Anther at meiosis of MT4B CS wheat
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhhg10k24   
Homology (BLAST) Top Hit Os04g0446300 [Oryza sativa (japonica cultivar-group)] >gi|38344552|emb|CAD40959.2| OSJNBa0027P08.20 [Oryza sativa (japonica cultivar-group)] >gi|113564480|dbj|BAF14823.1| Os04g0446300 [Oryza sativa (japonica cultivar-group)] >gi|116310237|emb|CAH67246.1| OSIGBa0140O07.14 [Oryza sativa (indica cultivar-group)] >gi|215701241|dbj|BAG92665.1| unnamed protein product [Oryza sativa Japonica Group] >gi|215704444|dbj|BAG93878.1| unnamed protein product [Oryza sativa Japonica Group] >gi|215765538|dbj|BAG87235.1| unnamed protein product [Oryza sativa Japonica Group] >gi|218194933|gb|EEC77360.1| hypothetical protein OsI_16063 [Oryza sativa Indica Group]
Score 875
Evalue 3.55389e-92
Total Hit Count 110
Registered year 2003
Contig Sequence     [ Download ]
>rwhhg10k24
GACCTGGTATACCAAGAAAAAAGACTGCAATGATGTATTATCTTAATGGTGCTTCATTCACCAGTTCAAACAGTACTGCTATCAAAAACATTGTCTATTT
CGATTAGGCTAAGCTTCATCCTGATAATGATGACAAGGGCTAGTAATTCATTTGCTCTTGCGCTCGTTGTTGTAGTCATCAATCAGTCTCTCAACATCCT
TCCAGAACAGGCCCTCCACAAGAACACCTTCCTTTGTAAACCATTTTGTAACACTCTTAGTGAAGTGGACAGGCTTGTGAGCAGAGATAGATTCTGGATC
CGCGCTGGCTATTGAAAGATTGTACATGTCCAAGAATCTTGGCAACTTTGAAGATATAACAAGGCCAGTGTTATTGAAAGAACCAGCAGGAGGGTGGGTG
AAGATGATGGCATCCTTTTCCTTGGTGTAGCTAAGGATCAGTAGCACCACATTCATCACCACATACAGCGCGATGCAACCGAGCAGGAACTCGCGGTTCT
GCGGGAACTTCTTCGGGTAGAACTGCGCGAGGAGCGCGATGGCGATCACGGCCGTCCCGATCAGGAGCTTCCAGTTGCCCAGCCGCGTGTTCTCCACATA
GCCCTTGCCCTTCACGACCTCGGCGACGGTCTCGTCGAGGAGGTGTTTGATGGAGTGGGGGTCAAGGAGGTTGGCCTTCTTCGGGGTCACCTTCGCGGGC
GTGGTCACCGCGCCGCCTCGTGCCGAATTCNGCACGAGGCTCCCCCGGATCCACCCATCCCGTTCGCCANCTCCGCCCTCGCTTCTTCCCGGNGCGCCAC
CGNCNGGGNATNCCTCNC
page-top