Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhhg4e13
Contig Information
Length 113 bp
Tissue Anther at meiosis of MT4B CS wheat
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhhg4e13   
Homology (BLAST) Top Hit endomembrane protein 70, putative [Arabidopsis thaliana] >gi|4406780|gb|AAD20090.1| putative endosomal protein [Arabidopsis thaliana] >gi|16604501|gb|AAL24256.1| At2g01970/F14H20.4 [Arabidopsis thaliana] >gi|110741070|dbj|BAE98629.1| putative endosomal protein [Arabidopsis thaliana] (no hit)
Score 181
Evalue 3.05798e-12
Total Hit Count 0
Registered year 2003
Contig Sequence     [ Download ]
>rwhhg4e13
GCACCAACACNAAGACATCCAACAAGCTCATGTTTCAAAGTACAAACAAGGTCTCAAATCATCGCTGGGGGCACAGCAAGACAAGCCCCAAAGAAAAGAA
AAGTACNTCTAAT
page-top