Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhhg8j17
Contig Information
Length 744 bp
Tissue Anther at meiosis of MT4B CS wheat
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhhg8j17   
Homology (BLAST) Top Hit hypothetical protein OsI_24976 [Oryza sativa Indica Group] >gi|125599188|gb|EAZ38764.1| hypothetical protein OsJ_022247 [Oryza sativa (japonica cultivar-group)]
Score 440
Evalue 8.26747e-42
Total Hit Count 12
Registered year 2003
Contig Sequence     [ Download ]
>rwhhg8j17
CTCCGATTGTTCAGAAAGAGATCTGTAAGCCCTGAGATAATAAGAGCTCCTGGAGTTGTGAATAGCAAAAATAGCCTAGGGGAATAATCTATGCTAAGAA
AATTCAGTTAACAACTACTAGAACTACTTTGCAGGCTTGCACCCATCTAACAAACCGAAGCACAGGATCATCACGGGTCAGGTGATTCTGCCCTCATGTA
CTTCAGAGGAACTGAACTGAGGCCACGAGAATGGTTCACAGCTTTGGATCACGCGCTCCTGGAGCTCAGCAGTCTGGCTTCATGCTGCCGTCGGATGATG
AGAGACTGCTGGTAAAGGTTCAGGTCAAGGCCATCGACGTTACGTGCTTGCAGAATCGCGTCATCGTTCGGCCGGATCAGGAGCTCACCAATGAACTGGA
ACATAGAACCGCTGCGGAAACTGATGTCCCGCAGGTGCTGGGCGTCGACCTTCAGCGTCGCGCTGCCATCTCGAATGACAGCAATCGCAGAGTCCACATC
GTATGACTGAAGGATTCCTGTTACCCGGAGGGACGCCCCTTGCTTGAACATCTCCGAGGAGGGCGCTAGCTCTTGCAGAGTGACAGGCACACCTGGTTTC
AGAGTAGAAGATGCCATCTAGCCTAATGCGCACGGGCTGCCTGATGAAATCCACAGCCCTGGCAAAGATTGCCTCCTGCTCCTCCACNGCGCGTCGCCGG
CGAGGCGGCCTCGCCAATGCGCGCAAACAGTACAGCCGCTCGAG
page-top