Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhhg4e21
Contig Information
Length 811 bp
Tissue Anther at meiosis of MT4B CS wheat
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhhg4e21   
Homology (BLAST) Top Hit pre-mRNA cleavage complex II protein Clp1 [Zea mays]
Score 693
Evalue 4.4516e-71
Total Hit Count 130
Registered year 2003
Contig Sequence     [ Download ]
>rwhhg4e21
AAGTAAGCCCAATATCGATGTCGTAAAACTTCATAAATCTGAGGGTGTTGTCCTAAGGAATTCAAAATATCGTCAAAAGACTAGGAGCTTTCGTATCAAG
GAGTACTTTTATGGGATTGCAAACGATCTGGCACCACATTCAAATGTAGTCAACTTTAGTGATGTTTCTGTTTTCAGAATTGGTAGTGGACATCAAGCTC
CACGGTCAGCTTTACCAATTGGTGCAGAGCCTGTGGCAGATCCCACTCGGCTTGTTGCTGTCAACATCAGCACTGATATGGTCCACACAGTGCTTGCTGT
TTCTTATGCGAAGGAACCTGATGAAATAATTTCGAGCAACGTTGCCGGATTCATCCATGTCACAGATGTTGACATCCAAAGGAAGAAGCTGACGTACATC
GCGCCTTGCCCAGGAGACCTGCCAAGCAGGCTGTTAATCGCGAGCTCCCTGACATGGTACGAGCAGGCTTGACCCGGTTCGAGGTTGGACATTGTAGGTA
GGTAACCAGATGGCTGATGACATGTTGTAACGCCGAAATGGATACTCTGTGCATTTGATAACTGGAACACTGCTGGTAAAGCTGAAAAGCTGAATGGGTT
GGACGATATCTCAGGCATCTTGCTGCGAAGCTTTCTGCTGACTTGCTTATGCTTTCTATGCTGCTGTGGCGGCGAAGATACAAATAGTTAGGTCAATGAA
AGATTGGTGTGCTCTTTTGTACGCTGTTGGGAACTAAGATATACTAGAAGACGAGTCCTTTGGCCTCTTCTCAAAAAAAAAAAAAAAAAACCCCANNTTT
TTTTTTTTTTT
page-top