Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whhg7e15
Contig Information
Length 698 bp
Tissue Anther at meiosis of MT4B CS wheat
Clones 1 Clones [Download: CSV  ,  FASTA ]
whhg7e15   
Homology (BLAST) Top Hit unnamed protein product [Vitis vinifera]
Score 177
Evalue 2.25855e-11
Total Hit Count 35
Registered year 2003
Contig Sequence     [ Download ]
>whhg7e15
GGAAGCGGAGAGGAATTGCCATTTCGGGAAAGGANAGGGGAATCAGATCGGGCANATGGCCGCCGGCGACGTCGCAACCGTCTTCCTGGAGATGAGCCTC
GGCACTCGCCTAGCCGTCTCCTTCCCCGCCGCATCAACCACCGTCGCCGACCTCAAGCGCAGAGTGAGCCATGAGCACGCCGCATGTTTCCCCAACTATG
GCCAGATCGCCGTCCAGTCCGTCAAGGTCGAGCAGGGAGGCTCGTGGTTCCACCTCGCCGACTCCATGGCCGTCCGGGACGCGTTCCAGTTCCACGGGGC
CAACGAAACCTGGCACCTCCAAGTAGACGCTCTGCCTCACCCTCAGCATCTCGGCCAAGGAATGGCCACCGAGGGACACTCCAAGGATTCCTCTGCTGCT
CACTCTGAACCAAGCTGTGAGATGCTGGCTGACCAGGTTAAAGTTGAAGTTGGAGCGGACTCTGAACCAAGCTGTGAGATGCTGACTGATCAGGTTAAAG
TTGAAGTTGGAGCGGAGGAGCCATTGTCAGCCAAGGGCAAAAGGAGCAGCAACGGGACTGATCCGAAGGGGTCGAAGGAAGCANAGGCCACATCAACANA
ACAGGGGGCATGTGAGAGGAAAANGCTGCGGCCAAGGACCANAGTTGGCAAAACACCCATCACCAAGGCGGCGAACAGCAGCGGCANCTCNGAGTCNG
page-top