Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhhg4f20
Contig Information
Length 866 bp
Tissue Anther at meiosis of MT4B CS wheat
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhhg4f20   
Homology (BLAST) Top Hit Pumilio-family RNA binding repeat containing protein [Tetrahymena thermophila SB210] >gi|89304178|gb|EAS02166.1| Pumilio-family RNA binding repeat containing protein [Tetrahymena thermophila SB210]
Score 95
Evalue 0.109476
Total Hit Count 12
Registered year 2003
Contig Sequence     [ Download ]
>rwhhg4f20
GTAGCATTAAGAAATTGGAAAGGGTTCCATCAGTTACAGATTCACCCATGAAGGGCACAAAAACATCCTGAAGAAGTAAATCTAATACCATACAAAGTAT
GTTACAGTTTTTGAAATTTTTCTACCAGTGCATGATCAGCAAATCGACCGTCCTTCAGTTTTAATAAATCAATCTAATTTAATGGCAACACAACACCTTA
CAATCACCCAAAATTCCATGAATATGGACATATCACCACTATTGTGAAGTCGTAGATGGTAATGGCCATCGCGCAATGTGAGCCTCGGAGAGGAAGAGCA
GGGTTTGGCAGAGCCAACCTTCACAGGTTGGCAGCAGACACACTTGTCATTGCTCACACGTGCGCTGCTCCCGCGCCCATCATCTTGGCTGCCACTCCCG
CCACTAGCAAGATGCACATAGCACACTGGAACAAACAAAAAAATATGAGAGAAGTACTGAACAAACTTTGACAGTGAGAAAGAATCAAAGTGCTACAGCC
AAATAAACTCCTCACTATCACCAGCAAGATTTAGTCTGAATTATGCATATCATTCCTTCAAAGCATTCATATACTCTGAGTTAATCAACAATAATCATGA
AGCACACGTGTCTACCCATGTCGTAGGCCATCGACTCCAGTCCCCAATGGACTCCTTCAACAATGCAATGTCTTCCTGTAGCAATGCAAAATTCAGTAAC
AAAGACAACAAGCCTAGTGAGAGAGTCAATAGCAAAATAAACACTTTCAACCAATTCCCGAGAAACAGAGAGTACGCATAGGAACTTACCATTGATGTAA
CAATGCAATGCCATTTCATATTTGTAGCTGGTTGGTTTTAGAGGGNATTCTGGTAAAAAATCTAAA
page-top