Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhhg8j19
Contig Information
Length 480 bp
Tissue Anther at meiosis of MT4B CS wheat
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhhg8j19   
Homology (BLAST) Top Hit RAR1 [Triticum aestivum]
Score 600
Evalue 7.93489e-61
Total Hit Count 205
Registered year 2003
Contig Sequence     [ Download ]
>rwhhg8j19
GAGATTTCGAGGTAATTACTCATCCAAGCAGCCTATTCTTGAATATCAGGTCACACTTCCAAGCATACTTCTCCAGAAATTGCGGCAAGATGCCAACCTT
ATGCACCAGGAGATAATACAACAAATATAACTCTTAATGCAAGAGTCATGGTGTGAACTCACACGGCATCANCATTGTGCCACCCCTTTGTGCATGGAGG
TATCTCCATAAATTCGTCAAACTCCTTGACATGGACATCGCAACACTTCCACCCTCTATTCCTGTCATGGAAAACCGCAGGGCCTGGATGGTATTCGCAT
GCAGCATCATGGTTATCCTTCTCCTTGTAGGTTTTACCACATCCTTTATTCTTACAAACCCTAGGCTCGTTTATATTAACAACCTTTTTCTTGGGCTGTG
GAACCGAGCATTTCTCGACAGGTTCCGTATTTGTACCATTTACAGCAACTGGTTTTTGTGCCTTGGGCTGTGATCCATGG
page-top