Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhhg4f21
Contig Information
Length 783 bp
Tissue Anther at meiosis of MT4B CS wheat
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhhg4f21   
Homology (BLAST) Top Hit unknown [Zea mays]
Score 808
Evalue 1.93217e-84
Total Hit Count 48
Registered year 2003
Contig Sequence     [ Download ]
>rwhhg4f21
AGTATTGAGAGCTCATAACCGAAAAAACAGGAGCGAAGGAGGACAAAACACATGGAAAAAGGACTATACAGCCAAACACAGATTAACCAGCAGCCATACT
CCATCTTTACTAGCCTTAATCACACCTAACATTTGTACATTTTTCTCAGTTCTAATACTCTACCAATCAAACCCAACCCGAGGTCAAAAGATTCGACAGG
CCAACGTTCCCTCTTCAACAGCAGCTATTCCACACCACAGCAATCATCAGCTTGCTATACTGGTATCACATCCATGTCTGAAGTATCTTCACATCTCACG
ACCAGTCCATCAAGGTTCGCTGGAAAGAAACAACTCCCCCACTGGCAACCAGATGAGATGGGCTCTGATGGAGGTACTATCATCAACACGCTCTCATTCT
TTTGAACGACACCCATCACGCTCACAGTGCTGCCTTCTTTGATGTATCCTTCTTTTAGGCGCATTTTCCGACCATCACTTGAGAGATTCCTTTCTCGTAG
CCATCTTAGAAATTCAGGAGACAAGTCCTTGTTCTCAGGATTGACGTCAATTACTACCGATTCATCGACATATGGTGTCACCCGTGCACCACTTCCTGTT
CTCACCAATGCTCTAAGCCCAGACTGAAAATCTGAAATGTAGAAATCGACCGCATGTCGCTCTGCTGTCCGTAATCCCCAGGTAAACCGGCGATGCTTGG
GGTTTGCAGTTTTTGAATCCCAGCCCCTATACTCATACAGCCTAGTTGAAGTGTACACACATCTTGGAATCCTTTGAAATGAG
page-top