Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whhg2h04
Contig Information
Length 712 bp
Tissue Anther at meiosis of MT4B CS wheat
Clones 1 Clones [Download: CSV  ,  FASTA ]
whhg2h04   
Homology (BLAST) Top Hit hypothetical protein OsI_23387 [Oryza sativa Indica Group]
Score 364
Evalue 4.90822e-33
Total Hit Count 20
Registered year 2003
Contig Sequence     [ Download ]
>whhg2h04
CCGCCGCCAAACCCTCGCCCCTCTTCCACCATAGCCCACCGAGCTCTCCCACGCCAGAAATTCTCCGAGCGGGAGCTCGCCCCTTCCAACGCCGCGTCCT
CCTCCAGCTCCACAGGGGCTGGTGTTCGTGAGATTCCCGTTGGTTCCCGCGACCCCGCGCGCAGTATCCCCTGGGTGGGCTCGTCCGCCATGTTTCCGCC
CAAAGGGCCCAATCCCTATGGGCAGCAGCCACCATACGGCGGGCAGCAATCTTACGGCGGCCAAATCCCTGGTAGCAGTGGATTTGGGGCCTCAGCTGCG
GCAGGTGCCCGTGCCGGACAGGGTGCTGCTGGGCAGTATGGAGGGCCTTACGCGTCGGTGTATGGCACACAGCAGGTTGGGGGAGTTGGTGGCAAAGGGT
CTAACTTGGCAAGACCAAACGATGACTATATGGCTGTGCGTGGATATGCACAGAAGCTAGACCAGTATGGTACTGATTACACATCAGAGAGAAGAATGTA
TGGTGAACACTCANCTAATCTTGGCAGGAGGGATGGCCTTACTGATTTGGATANAAGATATCCTGATCATCTACCTGCANCCCATCANATTCATGACCGT
GTGGAGCANGGTTCAACAATGCNCCATCAGCCACTTCTGAAANCTCANCTGGCGCCTGTGTCTGATATNANACAAGNCNATTACTTTGCANGAAANGTCT
GCTCCAATCCAT
page-top