Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whhg2h02
Contig Information
Length 634 bp
Tissue Anther at meiosis of MT4B CS wheat
Clones 1 Clones [Download: CSV  ,  FASTA ]
whhg2h02   
Homology (BLAST) Top Hit Os01g0270300 [Oryza sativa (japonica cultivar-group)] >gi|6721554|dbj|BAA89584.1| putative cationic peroxidase isozyme 40K precursor [Oryza sativa Japonica Group] >gi|6815079|dbj|BAA90365.1| putative cationic peroxidase isozyme 40K precursor [Oryza sativa Japonica Group] >gi|55700875|tpe|CAH69247.1| TPA: class III peroxidase 4 precursor [Oryza sativa (japonica cultivar-group)] >gi|113532234|dbj|BAF04617.1| Os01g0270300 [Oryza sativa (japonica cultivar-group)] >gi|125525347|gb|EAY73461.1| hypothetical protein OsI_01340 [Oryza sativa Indica Group] >gi|125569864|gb|EAZ11379.1| hypothetical protein OsJ_001204 [Oryza sativa (japonica cultivar-group)] >gi|215715345|dbj|BAG95096.1| unnamed protein product [Oryza sativa Japonica Group] >gi|215737165|dbj|BAG96094.1| unnamed protein product [Oryza sativa Japonica Group] >gi|215765726|dbj|BAG87423.1| unnamed protein product [Oryza sativa Japonica Group]
Score 443
Evalue 2.61568e-42
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>whhg2h02
TCTCCGGCGCGCACACCATCGGCAAGGCCAGCTGCTCCAGCGTCACGCCCAGGCTGTACCAGGGCAACGCCACCAGCATCGACCCCCTGCTCGACTCCAC
CTACGCCAAGACGCTCATGAACGCCTGCCCGAACACTCCCGCTTCCACGTCCACGGTGGACCTGGACGGCGCCACGCCGTTCAAGTTCGACGGCAGCTAC
TACACCAACCTGCAGAACAAGCGGGGAGTGCTCGCCTCCGACGCCGCGCTCACGCAGAACGCCGCCGCCGCGACCATTGTCAACGACCTGACCAACCCGA
TCAAGTTCTACGCCGCCTTCTCCATGTCCATGAAGAAGATGGGCCGCGTCGACGTGCTCACCCTCAAGAACGGACAAGGGAAGATCAGGACCAAGTGCAA
TGTGCCGTGAGGGTTCATCCAGGAGCGCCACACATTTTCTTGGATTTTTTTACTCTCTCCCTCTCCCTCTTATTTCATCGGCGCGGGTCAAATATATTGT
GCCCGCCATGATTAAGCTCCCAGATCTATATTGATTTGTTAAGTGCTGTGCCTGAGTATGTAAGATTATTAGTCACGACATGCGTTGCATTCCTCTTGCA
ATCAATCAAAGAAGGTGATTCGGCAAAAAAAAAA
page-top