Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whhg2g22
Contig Information
Length 676 bp
Tissue Anther at meiosis of MT4B CS wheat
Clones 1 Clones [Download: CSV  ,  FASTA ]
whhg2g22   
Homology (BLAST) Top Hit phosphoglucomutase [Triticum aestivum]
Score 1086
Evalue 8.31943e-117
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>whhg2g22
AGGCTACTGGTGCCTTCATTTTGACAGCCAGCCACAACCCAGGTGGTCCAACCGAGGACTTTGGAATCAAATACAACATGGGGAATGGTGGACCCGCCCC
TGAGTCTGTTACCGATAAGATCTTCTCTAATACAAAGACAGTTACTGAATACCTCATTGCGGAGGACCTTCCAAATGTTGATATTTCTGTGATAGGTGTC
ACTTCCTTCACTGGACCTGAAGGCCCTTTTGATGTCGATGTCTTTGACTCTGCTACAGATTACATCAAGCTAATGAAGACAATCTTTGACTTCGAGTCTA
TTAAAAAGCTTCTGGCATCTCCAAAGTTCTCGTTCTGTTTTGATGGTCTTCACGGTGTTGCTGGAGCTTATGCAAAGCGCATGTTTGTGGATGAGCTCGG
CGCCAGTGAAAGCTCACTGTTGAACTGTGTTCCAAAGGAAGACTTTGGAGGTGGTCATCCAGACCCTAACCTCACCTACGCAAAAGAACTGGTTGATCGG
ATGGGTCTTGGGAAAACCTCAAATGTTGAACCCCCTGAATTTGGTGCCGCAGCTGATGGGGATGCTGACCGCAACATGGTTCTTGGTAAAAGATTCTTCG
TGACACCATCANATTCGGTTGCCATTATTGCGGCCAATGCTGTTCANTCAATTCCTTACTTTGCTTCTGGCCTGAA
page-top