Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhhg8j24
Contig Information
Length 669 bp
Tissue Anther at meiosis of MT4B CS wheat
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhhg8j24   
Homology (BLAST) Top Hit hypothetical protein OsI_24020 [Oryza sativa Indica Group]
Score 402
Evalue 1.69739e-37
Total Hit Count 70
Registered year 2003
Contig Sequence     [ Download ]
>rwhhg8j24
GCACTTACAGCAGTATTGATACATGTCACAGTAGAGCCCCCGGTGTTCCGATGAGGGCATTCTAGAAAACAGACCTTAAAAATGACAGAAACACCAGTGC
TGGTATTGGTTATAATCCATTGTACATCACACTTTGTATGTTCTTAGTGAAAGTATTCTGTCTAATGTGTTGTGATCCACAGCCACAAGGGGAGCAGAAA
TGCCTACCTAGCTATGTATCTACAGCTCACCCCTGTGCCTTGCTTTGTACAAACCATGGTTCTCTTGTTTCTTCTATATATAGAAAGTGAAGTTGTAGTA
ACAAAAAAATCATTGAAAAGCATGATAGCAAAGTATCTGCCGGGTATGGTTGATGAAAACTCTGCAAGCTTTCATTCCCAGATCCATTTTCCATCTATTG
CCTTAGGCGTCTGGAGCATGCTGCCGGAGCGGCTGGTGCTCGTTGTTCTGGCTGTCGAGCGGCATGTACTGGGACATGATGGCCATGATCTCCGAGTCCA
TGTACGACCTGAGCCTGTACTTGTAGAAGATGAAGCCGGCGACCCCTAGGCCGGCGGCGCAGGAGACGGCGAGGAGGGCGACGAGCCAGCCGAACCTGGA
CATGCTGTTGGCCACGCAGACGTCCTCCCCGCGGATGTACACCTGGTTGCCCCTGCAGCCGCACTCGTA
page-top