Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhhg4g11
Contig Information
Length 613 bp
Tissue Anther at meiosis of MT4B CS wheat
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhhg4g11   
Homology (BLAST) Top Hit ATP synthase beta subunit [Triticum aestivum]
Score 593
Evalue 9.83285e-60
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>rwhhg4g11
GCTTNTTACGGGTAAATTGGAGTAAAAACGAACAAAAACAAGGATCCCTCAGCAGGANCNGGCACACTCCTGCTCGGGAGCAAGTCTCGGGCNAACAGCT
GAAAACCCAAAAAATTTAACTTGTACAGGGCGGNGGNGACACCTCGCCATCAAGCGTTCTCGTTGGCNATCTTCTCCGCCTTGGCGATGACTTCGTCNAT
GCCTCCAACCATGTAAAACGCGTGCTCCGANATGTCGTCGNACTTGCCGTCCAAAACACCCTGGAAACTTTGGACGCCCTCCTTTAAATCCACATACTTC
CCNGGAGCACCAGNGAAAACTTCGGNAACATGGAANGGCTGGNTCAGGAACTTCNGGATCTTCCTTGCNCGAGCAACCGNCNTCTTATCATCCTCACTGA
GCTCATCNATACCCAAANTGGCAATGATATCCTGAAAATTCTTGNAGTTCTGAAAAACCTTCTGGACACCACGGGCAGNGTTGTAGTGATCCACACCCAA
AACGNGGGGAGAAAGCATTCTTGATGNCNAGTCCAAAGGATCNACNGCAGGGTAAATGCCCAGNTCANAAATCTGTCGNGACAACACAGTATTAGCGTCA
NNATGGGCNAAGG
page-top