Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhhg10k06
Contig Information
Length 665 bp
Tissue Anther at meiosis of MT4B CS wheat
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhhg10k06   
Homology (BLAST) Top Hit hypothetical protein OsI_30042 [Oryza sativa Indica Group]
Score 192
Evalue 3.7259e-13
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>rwhhg10k06
CAAAATACATCCATATGGGGCATACAAAATGTAAATCAAATATTATTGAAGGGGAGATTGTTGACCTGGTAGCAACGGTATCTTCCTATCAGAACCATGT
GACTACAAAAAATCCTAATGTACTGAAAATACATCCTTGCCAATTTCTTCAATAAACTAATATCAGATAAATGACCTTCTCGACCAGCAATCTTCTCCTT
CAGAATGTACCAAAGACATGGAGGCGATCAGTACCCAATGGCCATATGCAAGGCCGATGCAGCAAGGATAAAGTAAACAATCTTAAGAGGGAAATGTGGG
TTCACCAAGAAAATGGAGGCGACATCGATGAAATCCCCGTCACTGCATGCGAACCTGACATGATGTGTGTGTGGAGAGAGAGAGAGAGAGAGAGAGAGAA
CCATATCTCAGCACCAACACGATGTTGGGGGAAGCCTTCTTCAAGAATCACCANCCTATTTGTTTTCGTAACATATGCTTTTATCGCAGCTCTATCCAGT
GGCCTANCTGATCGANGGTTGATCACCTTAGCACTGATTCCTTCCTTTGACAGTATTCAGCAGCGTTATCCAGTGGAGTTTCAGAGCCACTGGGCTGAGC
CACACCACAAGCTTCTCCTTCGATTAACCNTCCCATGGACGGCGGCGGCGGATGGAGGTTGAANA
page-top