Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhhg4k04
Contig Information
Length 385 bp
Tissue Anther at meiosis of MT4B CS wheat
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhhg4k04   
Homology (BLAST) Top Hit hypothetical protein OsI_16242 [Oryza sativa Indica Group]
Score 216
Evalue 2.68019e-16
Total Hit Count 64
Registered year 2003
Contig Sequence     [ Download ]
>rwhhg4k04
TGTTGCCAATGTGANCANAGGGCGCTACNGCGTCCAGNGTGATGTTTGCTCCANAGAAGCTCGACTCAAAGGGGTTGCGAATGCCGCCCCGAGTCGTCAA
CTTTGCGCCATCAGGTCCATTCTGCTGTACCGCCGACTCCGTTTGCGAAACCGTAGAGCTCTCTTCGCCGCCGTTGCTTTCCTCCCTTGTCTTTGTGCCA
TCCCCCATGTCTCTTGGGTTGAAGTCATGTTCATCTTCNACAGCACCGGTCTCGCACTTCGGATGGTTCTCACTCTTGACATCACTANGCTCTGCACCAT
GTGCTCCATCAATTCTCATCTTGTTACCGACATCTCTCTGATCACTGCTCTCTTCNNATGCTTGGACATCCNANCTGCCTGAACT
page-top