Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhhg9a06
Contig Information
Length 689 bp
Tissue Anther at meiosis of MT4B CS wheat
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhhg9a06   
Homology (BLAST) Top Hit hypothetical protein OsI_24576 [Oryza sativa Indica Group]
Score 775
Evalue 2.19887e-92
Total Hit Count 108
Registered year 2003
Contig Sequence     [ Download ]
>rwhhg9a06
TGATATTGCGCCGATACTCGCTTAGGTGGAAGCTTCCNAAGGATGAAAAGGACCAGCGCGGAAGGCAGTATCTCTGTCAACATATAATAGAAGAAATCTA
GGATTGGATGATCTAAAACCTCCNAAGAAACATCAGCATCAAATGCAGATACTGCCACCACGATGCATCTTATCAGGAAACAGGTGCAGCAGATTGTCGT
CACAGTCCCAACCTCATAAAGCTTCTTTTTTCGCCCCTTCGATTCAATGGGGAAACGTCTCAGCAAGACAAACAACCTTCCACCATATACTGCGAAACCA
AGAAGGGCCACAGCGGAGACAGATACGATGAAGATTTTGCTCACCAGCTCAACCAACGCATTGTCGTTTATTCCAAGGTACACCCAAATACAGATCTGAA
TTGCATATACGATGCTATTAACGGCTAGGTATATAATTCTCAACTTATCGGTGGGGAGACTCCTAGCCTGATGGTATATTTCTGCCCAGAAAAGAACAAG
TAAGGTGTAGGCCGAGAAGAACAACAAGCCGGGGAGGTCTAGTAACACCAACTTATAAACTTTTGTTTGGAGGAGGAAGACATAAGCATGGGAATCCGAA
TACGACGGCACGAACCCCATTGACGACGAAGTTCATGAGGTGGAACACCTTCTGCGTGGTCCAGCCGAACTCNGGGCACTCTGCGCTGG
page-top