Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhhg4m08
Contig Information
Length 136 bp
Tissue Anther at meiosis of MT4B CS wheat
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhhg4m08   
Homology (BLAST) Top Hit AML6 [Hordeum vulgare] (no hit)
Score 609
Evalue 1.94836e-61
Total Hit Count 0
Registered year 2003
Contig Sequence     [ Download ]
>rwhhg4m08
TTCAGGAATACAATACGTTACGTACNCATTATCTTATCTTACAGATCCGGGTGCCCGGCCAGTTGCAGCCAGGCACCGATCCTCTTTATTTATTCTTAAT
AACAGAAGCGGNTCTGCTTCCGGATCNTCGCGTCNA
page-top