Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhhg8k13
Contig Information
Length 717 bp
Tissue Anther at meiosis of MT4B CS wheat
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhhg8k13   
Homology (BLAST) Top Hit AML6 [Hordeum vulgare]
Score 609
Evalue 1.94836e-61
Total Hit Count 155
Registered year 2003
Contig Sequence     [ Download ]
>rwhhg8k13
CATTCAGGGTCAGATTAGCATTCAACACCCCTCCAACTCAACTGTACAAGTTTCCAACCCTCAGAACCCTAAACCCAAAACGCACATCACCTCCTGCGCA
TTTTCGCCGTCCCTCCGAACTCTAGTTCGTCGGCGGGGCAAGCACGAGGGCAAGGGCAACTTACTTACGGCGAATCGCCGGCAGACCGTCCGAACTCGCT
ACCATGCCCCCAGCCTTGCCGGGGAGAAAAACAAATAGCAAAACTGGGGGTGATTTATTGCAGCAGCTTCTTCTCTGTTCTCCAGTTAGTGAGCGAAGAT
CGAGTCGTCGCCCTCGGCCGCCGCGTTGGCCCTGTGGCTGGAGTTCTCCTGGTTGGGCGAGGTCGACAGGCTCGCGTCCCCTCTGGTGTCCGCGCTGTGG
AGCGGCCTGTTCCTCCCGGACCTAGGCCGGATGTTGTTCCCGACAGGGAAAGGTTCCTGCTCCCCTGCGTTCGGACCATCCTTGTGGAAGAGTATAGGGC
GGCACCATTTGTCTTCATTCATCAGGCTAGAATTCCGAAAATGAGAAACCAATTCATTCCTGCCCTGGATTCTAGCATACGCGAGTGTCGCCACCTTCTC
GCTATTGAATTTTTCCCATCTCTTGCCATTAAACGTCTTGTAAAACGGAATTATGTGCTGCGGATCGGTCATGTTGATGAAAGCATANCCCACGTTGCAT
TTGTTCTTGAAGTCNAT
page-top