Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhhg4m10
Contig Information
Length 758 bp
Tissue Anther at meiosis of MT4B CS wheat
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhhg4m10   
Homology (BLAST) Top Hit hypothetical protein OsI_03156 [Oryza sativa Indica Group]
Score 145
Evalue 1.3717e-07
Total Hit Count 18
Registered year 2003
Contig Sequence     [ Download ]
>rwhhg4m10
CAAAGACCATTCATAATACACATTAGGGAAGAAGGACCATACATAATGATAGCAAGGCCTTTATACAAAAGACCAACGATAATCAGGTAGCAGTATACAT
AGGTAAGTGTGCAATGCCCCATTGCTCCTCACGGCGAACAAATACAGAAAGCTTACTGGCATGACTCATTAACAATAAAATAATATCAAATCCTCCTTGA
ACTTCTCATGAAGAACCAATAGCATCGCCAAACCATCATTTATCCCAGAATATATACTGGACGAATCCTGCTTTTGGAGTGGCATATGCAATTGTCACAA
AATACAAAAATATATCTTTTGATTCACGAGAGCTACTCCTGGGCAGTAGATTTTTTCTTGCTCAAAAGGCCTCCTAGCTTGAGTTCATTGATCTTTGCAG
CAAGGATGAAATCATTATCTGTTAAACCACTATTTTCACTCCGTATTGTATGGCTCGTTCTTGTTCATTTAAGTTGATTGGATTTCCCTAAACGAAAATA
AGTTTTATCATGACAATGGCCAACTGCTGATAGGCATCAAGCGCCTACTGACTGAGTGAGTCCACACATCAATTTTCACATTATTCCAACCAACAAGATG
AAGATCTGGGTGGTGACCTGGAAAAGCATATCCATTTAAAGTTTTAAACATAATTTGCCAAGATTGTTACTGAAACAAAAAAAAAGNGCCAAGAAATTTG
TTGGATTCTGGGTGAAATACAAAATCTCTTGGCCAATTTCAGGGGGTATTTTCGTTTA
page-top