Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhhg8k14
Contig Information
Length 741 bp
Tissue Anther at meiosis of MT4B CS wheat
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhhg8k14   
Homology (BLAST) Top Hit hypothetical protein OsI_10511 [Oryza sativa Indica Group]
Score 657
Evalue 5.68571e-67
Total Hit Count 281
Registered year 2003
Contig Sequence     [ Download ]
>rwhhg8k14
AAAAGGTGTTCATTTCTTCCAAAGAGACGTGTACAAATCGTAGGAGGCCCAAAACCACCTCACAATCGATTTGTATATATAAGCATTACAAGAGACGTGT
TGTTAGCTACACTCAAGTAAACCTATACAACAGCGAAATCCAGAAAGGCTCTGATGAGCATGGGAGCATGCTTGATTTTGAATATCTGGATTCCTGGGAG
CTGAGTTCCACAAAAGCAGATCTGCTAGTCCGCGGAAGAATTAGACCTTCGCTAGATGCCCAAGGGAGACCTCCTGATCAAACCCAAGGTAGCAATCTGA
CACAACAATCAGCTTTGCCTCCTGCATATTCAACATCGGTGGCAATTCCATGCGAGTGTTAAGCACACGATCTGCAAAACTAATTCTTTTCAGACCATAT
AGCTCCGAGCTTGTAATATTCCCCAGGACCAGCCACCAGGCTTCTTGTTTCGCCTTAGGGAATTTAGAGGAAAATACTCTTGGCGAACGACGCGTATTTT
TAATTTGCATTCTAATGTTCAGCATTTGAGGTTTTGACTGCTCCTTATCTTCATTCTGTAGCTTAACTTTAACATCAAGGCGAGGGAAATGTTGCAGATC
CTGATACAACTCTGCAGCAGAAAACGGTTGAAGCAACTTGTGTAATTCTTCACGAGAACGATCTAGCAAGCTCAGAACTGNTGAAACTCCTCTGCCTTTA
AGATGATCTAGAAGGTTATCATTCATGGATGGTAACATCAA
page-top