Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhhg4l14
Contig Information
Length 852 bp
Tissue Anther at meiosis of MT4B CS wheat
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhhg4l14   
Homology (BLAST) Top Hit peptidylprolyl isomerase [Triticum aestivum]
Score 918
Evalue 3.95955e-97
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>rwhhg4l14
AAAGCTCTAGAAATTTCGTTTAAAACGAAATAGACACTCTTTTTACTAGAATCGTACGTCAGCAAATTATGAGTACATTATCAAGGCACGCAGCCGATCA
CAGACGAGGCACAAGCTGCAGAACAGAGGACAAGACAACCAAAACCACGGTACAACGCTGATACAAACTCCAGACCCGGCTGTACCAGGACGCGGCAGAC
CCGTCACGCGGTGCTGTCGATGGCCATAGGCTGCGCGTTCTGCTTCCCGGCGGCGTTCTCCGTCTTCCTCCATTTGGCGAACATGTTGCCGTAGAACTTG
GCGTCCCTCTTGTTGTACTCCCTCAGCTTGTCCTTCAACGCCTTGTACGCAACCTTCACCTCCCTGTTGTCTGGGTCGATCTCCAGAGCCTTCTTGATAT
CTAGTTCTGCCAGCTCCAGATCCACGAGCTCGGTGTACGCCTGCGCCCTCCGGTACAGAGCCTTGACGTTTGTGCTCTCCAGCTCCAAAACCTTGGCGCA
GAGTTTCTCTGCTTCCTTGTAATCCTTGAGTTTCAGTTTGCACGCTGCGTTGTTGAGCTTGATGCTGATCTTCACTGCCTTGGATTGCTTCTTCTCGTCC
TCGCTGAAGGAGCTGTCATACTCAATGTACTTTGCAGCCTTCTCATATCTCTTGGAAGCCTTGGCGTACTTGCCCATCTTAAACCACGCATTTCCTTCAT
CTTTCTTTTTAGCAGCTGCTTCGATGTTCTCAGCATTACTCTTCAAGTCCCAAGATTCTTTCTCCTTCTCGAAGGAAACGAGGTCCACTTCATAAAAGAC
GGTGGAGTTGGGAGGAACCATANCAATATCAAGCTTCGTCTCAGTGGAACCG
page-top