Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhhg4l21
Contig Information
Length 793 bp
Tissue Anther at meiosis of MT4B CS wheat
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhhg4l21   
Homology (BLAST) Top Hit hypothetical protein OsI_09713 [Oryza sativa Indica Group]
Score 795
Evalue 6.36124e-83
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>rwhhg4l21
ACGTGCGCGCTAGAGCATTTAGCATGTTTCACATGCCTCAGTGGAGCAAAATTTTATTACAGCCAACAAGATCCCTAGTGTTCCTCAAGACTAGCTAATA
ACTGGGTTGGGCTGCTGGGGCAGCTTCACTTCTTCACCTCCTCGTACTCGGCCTCTGGGGCCTGGTCGCCTCCGCCCTGCGAGCCTCCTTCCTGGGAACC
ACCGCCAGCCGCGCCGCCTCCAGCCGCACCACCACCAGACATGTGCTCCCCGATCTTTGAGACCGCCTTGTTGGCCACTTCCATCTTGCTCTTTATCTTC
TCGATGTCGTCAGAGGCCATCTCCGCGCGGAGATCAGCAACCGCCGTCTCGATCTCGGTGGCGACCTCCGCGGGGATCTTGTCCCTGTACTCTCCCAGGC
TCTTCTCGATGCTGTAGATGGTGGTGTCTGCGGTGTTTCTGATGTCAATGAGGGCCTTGCGCTCCTGGTCCTTCTGTGAGTGCAACTCAGCCTCCCGCAC
CATCTTCTCGATCTCGGACTCAGAAAGCCCACCGGACGATCGGATGGTGATCTGCTGCTCCTTTGCGGTGGCCTTGTCCTTTGCAGAGACCGTCACAATT
CCATTGGCGTCAATATCAAACGTGACCTCAATCTGTGGCAGTCCTCTTGGGGCTGGTGGGATGCCCACAAGATCAAACTCGCCAAGAAGTTTGTTGTCTG
TTGCCATCTCACGTTCACCTTGCAGGACACGGATACCCACTTGCGTCTGGTTGTCAGCAGCAGTTGAGAACANCTGGCTTTTTCTTTGTGGGG
page-top