Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhhg8p11
Contig Information
Length 744 bp
Tissue Anther at meiosis of MT4B CS wheat
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhhg8p11   
Homology (BLAST) Top Hit hypothetical protein OsI_30986 [Oryza sativa Indica Group]
Score 666
Evalue 5.11839e-68
Total Hit Count 193
Registered year 2003
Contig Sequence     [ Download ]
>rwhhg8p11
AGCCTTCGCTGCTTGCTTCTCGGCCTGTTTCTTCTTCCTTTCCAAAGCAAGTCTATTCTTCTCGATTTCCTCCTGTCTCTTGATCTCTTTCAACTTTGCT
ACATCAACCTCTTTAGGCTTGGGCTTCTCCTTTGGAGGCTCAGCCTCATAGGCATCATCATCAGCATCCACAGCAGCTTTTACCTTAGCTGACTTGGCAG
ATGCTTTTGCAAGGGGCTCTTCTTTGGGGGCGACTTGAGGAGCAGCAGCTTCCTTTGCTTGTTTCAAAGGCGCTTTTGATGGGATAGGCTCCTGTTGCAC
AGGTGCTGCTGGCTGCTGTGTTTCGATAAATATGGGCTTCTCATCAGGATTCCTCATCCGGCCATCTCGGGTCAGCTGTCGTCCATTGAGGGAAGTGAGG
ATCCTCTTCTCGTAGTCCTCTCTAAAGGTCTTGCTGCCGCACCATTGTGTCATGAACTTCTCAACCTCAGTCTTGTGGAGCTCTTGCAATTCTTCCACCT
CATTCCTAGAAGAATAATCCCTGGCTCTGTTCAGAACTATGCGGTTTTGATGGAAGGATGCATTGGCAAGATCACGCGCTTTTCTCAATTCGGTCAATGA
CTCATACGCTTTATCCTTTCTGGCGGTAGCTGCATTTAAATCTTCTTGAAGCAAAGCAATCTCGCCATCAACAACCCTCATCTCATCGTCCAGGACCTTA
ATCTTANACCTGACTGCTTGTCGCTCCTTCTTTACTCCATCTAT
page-top