Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whhg2b03
Contig Information
Length 712 bp
Tissue Anther at meiosis of MT4B CS wheat
Clones 1 Clones [Download: CSV  ,  FASTA ]
whhg2b03   
Homology (BLAST) Top Hit hypothetical protein LOC100193602 [Zea mays] >gi|194693668|gb|ACF80918.1| unknown [Zea mays]
Score 1029
Evalue 3.76401e-110
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>whhg2b03
TCGATATGACCTTCGGCCTGCTCGACCTGGACGAGGAGCACATCGTGCACATCGACGCCGTCTTGAAGCGCGTGCTGCTCGCCGTCGGCGTGCGCATGGA
CGACTACCTCCCGTTCCTCCGCCCCTTCTTCTGGCGGAAGCAGCTCCGGGCGCTCGCCGTTCGCCGCGAGCAGGTCGACACGCTCCTCCCACTCATCAAC
CGCCGCCGCGCCATCCTCCGCGACATGCAGAGCTCGCCGCCAGATCCCAACGTCGCTGCGCCCTTCTCTTACCTCGACTCGCTGCTCGACCTCCATATCG
AGGGCCGCGAAGGCGCAGACGACGAGCTGGTCACGCTGTGCGCGGAGCTGATCAACGGCGGCACCGACACCACGGCCACTGCCATTGAGTGGGCCATGGC
GCGCGTCGTGGACAACCCGTCCATCCAGGCCCGGCTCCACGAGGAGATCATGCAGCAAGTCGGCGACGCCCGGCCAATCGACGACAAGGACATCGAAAGC
ATGCCGTACCTCCAGGCCTTCGTCAAGGAGCTCCTCCGGAAGCACCCGCCCACGTACTTTTCGCTCACCCACGCCGCCGTCAAGCCTGGGAGCAAGCTCG
CCGGCTACNACGTGCCCACGGACGCNAACCTGGACATCTTCCTCCCGACCATCTCGGAGGACCCCAANCTGTGGGACCGGNCGANNGANTTCNANCCNNA
CAGGGTTCCTAA
page-top