Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whhg2c09
Contig Information
Length 756 bp
Tissue Anther at meiosis of MT4B CS wheat
Clones 1 Clones [Download: CSV  ,  FASTA ]
whhg2c09   
Homology (BLAST) Top Hit Heat shock cognate 70 kDa protein, putative, expressed [Oryza sativa (japonica cultivar-group)]
Score 1085
Evalue 1.36269e-116
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>whhg2c09
CCTCCTTGACCCGCCGCCGCTTCTCCCACCCCGAAAGAAAAACACACACACAGTAGAGAGCTTCAGCTTCCCCTGAGAGCGAGAGATGGCGGCGAAGGGC
GACGGGCCGGCGATCGGCATCGACCTCGGCACGACCTACTCGTGCGTCGGCGTGTGGCAGCACGACCGGGTCGAGATCATCGCCAATGACCAGGGCAACC
GCACCACGCCGTCGTACGTCGCCTTCACCGACTCGGAGCGCCTCATCGGTGACGCCGCCAAGAACCAGGTGGCGATGAACCCCATCAACACCGTCTTCGA
TGCCAAGCGTCTCATTGGCCGTAGATTCACCGATTCTACTGTCCAGAGTGATATTAAGCTGTGGCCCTTCAAGGTTGTTGCTGGACCTGGTGACAAGCCC
ATGATCAACGTCCAGTACAAGGGTGAGGAGAAGCAGTTTGCAGCTGAGGAGATATCTTCTATGGTCCTCATCAAGATGCGCGAGATTGCAGAAGCTTTCC
TTGGCACCACTGTGAAGAATGCTGTTGTCACTGTACCTGCATACTTCAATGACTCGCAGAGGCAGGCTACCAAGGATGCTGGTGTCATTGCTGGCATCAA
TGTCCTCCGTATCATCAATGAGCCAACAGCTGCTGCCATTGCTTATGGTCTTGACAAGAAGGCTTCCAGTGTTGGTGAGAAGAACGTCCTCATCTTTGAC
CTTGGAGGTGGTACCTTTGATGTCTCTCTTCTCACCATTGAGGAGGGTATCTTCGA
page-top