Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhhg10k10
Contig Information
Length 540 bp
Tissue Anther at meiosis of MT4B CS wheat
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhhg10k10   
Homology (BLAST) Top Hit hypothetical protein OsI_16675 [Oryza sativa Indica Group]
Score 178
Evalue 9.46259e-12
Total Hit Count 3
Registered year 2003
Contig Sequence     [ Download ]
>rwhhg10k10
GAAGATCGAAACTCCATATGTACAATTANGTTTGAGTACNACCCGTCACAGCTGCATGCATTATATGCTTTTCCTGATCTATTGAGTTCTCTGGNTTCTG
GAGGTGGCTCTCANCGTCCGGCATCAACGAGCTGTTANAGGATCGTCCTCCTCACCACCACNAGNGCCGCAGCAGAAGCAGCAACAGCAGCACGAAAGGA
GCATGGCGGCGTCNCAGGNGAGCTCNAACGCGGTGGNCACCATCGACGACGAGCGGCCCTCGAGCAGAGGCGCCTCGTCCCCGTCCTGGCCCTGCCGCCC
TTGCCCCTGCCCCTGCGCGCGCTTCTTGTGGGCGAGGTTGAANTCAAGCTTCTCCAGGTAGGCGTGCTTGAACGAGTCCCGGATCCGGAGCGACGGCCAC
AGGTGCATCTTCGCNGGGNGAGGAGGGGGCGGCGGCGGGGGCTGGCCGGGCCGGGGATTGTCTTGATCTTACGGATCANGGGGGTCGGCGCGGACGATTG
GGACGGTGTGGGTTGCNGATTTGGGATCGGATGATGGNCG
page-top