Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhhg8l10
Contig Information
Length 317 bp
Tissue Anther at meiosis of MT4B CS wheat
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhhg8l10   
Homology (BLAST) Top Hit hypothetical protein OsI_35792 [Oryza sativa Indica Group]
Score 350
Evalue 7.91853e-32
Total Hit Count 58
Registered year 2003
Contig Sequence     [ Download ]
>rwhhg8l10
GAAGAGCAAAGTTGCTACAGATTAGNTAGGATGTCTCTCATCTCNTTCACAGATGTCANCGNTTCGGTGGGATATATTTTGGCAATCANTTTGAGGAAGG
NTGTGNATTTATCNANAAACTCCTTCTTGCATTTTTCCCATAGAGAAGGTAGCAACTCTTCCGCAGTCATATTTNTCTGNANNTTCCTATACNTTGCAGN
GATTGTTTTGTCCAGACCAGTTAGGCTGGACTTCAGCATCTTGCGGAAATCTACCTTCNACATTCCAACTTGGAAGGCTATCTCCTCANGACTCATGTTG
NACATCTGTTCCTCNAT
page-top