Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhhg8l11
Contig Information
Length 728 bp
Tissue Anther at meiosis of MT4B CS wheat
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhhg8l11   
Homology (BLAST) Top Hit OSIGBa0105N24.5 [Oryza sativa (indica cultivar-group)] >gi|116308980|emb|CAH66102.1| OSIGBa0101K10.1 [Oryza sativa (indica cultivar-group)] >gi|125547401|gb|EAY93223.1| hypothetical protein OsI_15029 [Oryza sativa Indica Group]
Score 622
Evalue 6.22489e-63
Total Hit Count 53
Registered year 2003
Contig Sequence     [ Download ]
>rwhhg8l11
TATCGAATTCTGCAGGTCCCCAGCCTCACGAATCCTATGGGCAAAAAGCGGGACATGTACTGCTCCAAAAGTATGCGTAAAACACGACGAGTTTCCATAT
TGATAGCTTCCCCTCCTATCACAATCCCCTTACTGGCTTCAGGTTGTCTTAGCCTTTGCGGTCCTTCTCTTGGAGTGCCTCCTTGGGATGGAGTTCTTCA
TTCCCAGGAAGAAGAGCAGCGCGCCGAAGAGGGCCAGGTTCTGTGAAAACATGGTGAAGAGCTTGGCAAATTGCTGGGACTCCATCTCGTAGTTGTAGAA
GTCGTACACGACAGGGGTTATGAATGCCAAGTAAACAAGCAGTACGAGCGCTCCGAACGAGCTGCTGATGATGAAAAGGAGACCACCAAAGGCTTTAAGA
AACATGGTAAAGGCAATGACAGACTTGATGTCAATGTGTGGCACCGCCATCCCAATGCCGGCGGACACCTGCTTGACAAACAGGTTGAACTTGGGCTTCA
GAGACTTTGCTGCTGGTCCTCCATCCGTTCCAAACTCACTGAACTCTTGGTAGGCGGAGAGGAGGAAGACGGAGGCGAAGAGCACCCTCCCGACGAAGGA
GACGAACCCCATCGCTGCTGGCCCTGCCCCGACTCGCCGCCGCCGATGCTGCTGTCCCGCAGGCCGCCTCGAGCTCCCCGCCCGCGTCTGGTGTCTGGTC
CTCGGTCGCGACGACNACTGGGCTGCCC
page-top