Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhhg8l24
Contig Information
Length 247 bp
Tissue Anther at meiosis of MT4B CS wheat
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhhg8l24   
Homology (BLAST) Top Hit hypothetical protein OsJ_019365 [Oryza sativa (japonica cultivar-group)]
Score 148
Evalue 2.04187e-08
Total Hit Count 192
Registered year 2003
Contig Sequence     [ Download ]
>rwhhg8l24
ATTGATGCTTATTCTCGCAACACGATCATCATCATCATCATCTTCTTCGTTCTTCTGNTAAAAATAATAGTGAGCCATTCCNTCCCCAGCTTCGAGGAAA
GAAAGGAAGCAACCAAACGANAGGCTANCCGGAGCTCGCTCGCTCGCTCTANGANAGGATGGCCGGGTGGCAGTACGGCCCGTTGACCCNNCCGTCGGCA
ATCTTCTTGTAGGCTGCCTCCGTCANGTGGATCCCGTCCCAGCTCAC
page-top