Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whhg2a13
Contig Information
Length 749 bp
Tissue Anther at meiosis of MT4B CS wheat
Clones 1 Clones [Download: CSV  ,  FASTA ]
whhg2a13   
Homology (BLAST) Top Hit putative aconitate hydratase 1 [Sorghum bicolor]
Score 1117
Evalue 2.60869e-120
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>whhg2a13
TTGCTGATAGGGCTACTATTGCAAACATGGCACCAGAATATGGTGCAACTATGGGTTTCTTCCCAGTTGATGCCAAGACATTGGACTACCTGAAGCTAAC
TGGCAGAAGTGATGAAACTGTGGCCATGATAGAGACTTACCTGCGCGCCAATAATATGTTCGTCGACTACAAGCAGGTTCAAGCTGAAAGAGTGTATTCA
TCTTATCTGGAACTTGACTTGGATGAGGTGGAACCATGTCTGTCCGGACCAAAACGGCCTCATGATAGAGTGACATTGAAGAACATGCAGTCAGATTGGC
TTTCTTGCCTGGACAACAAAGTAGGGTTCAAGGGTTTTGCTGTCCCCAAGGAATCGCAGGCTAAAGTTGCTGAGTTTTCGTTCCGTGGGACGCCAGCAAA
GATAAAGCATGGTGATGTTGTAATTGCGGCTATCACCAGTTGCACCAACACATCAAATCCTAATGTAATGCTGGGAGCTGCTTTGGTTGCCAAAAAGGCT
TGTGACCTAGGCCTGGAGGTGAAACCATGGATTAAGACAAGTCTTGCACCAGGTTCTGGTGTTGTGAAGAAGTACTTGGACAANAGCGGTCTGCANAANT
ATCTTAACCANCTTGGCTTCAATATTGTTGGCTATGGGTGTACAACCTGCATANGAAACTCTGGANATCTTGATGAATCCNTANCTGCTGCNATTACTGA
CNATGATGTTGNCNCTGCTGCTGNGNTNNCTGGNAACANNAATTTCNAA
page-top