Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhhg8m21
Contig Information
Length 540 bp
Tissue Anther at meiosis of MT4B CS wheat
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhhg8m21   
Homology (BLAST) Top Hit hypothetical protein OsJ_029773 [Oryza sativa (japonica cultivar-group)]
Score 149
Evalue 2.18149e-08
Total Hit Count 37
Registered year 2003
Contig Sequence     [ Download ]
>rwhhg8m21
CCTCCCGCCTCTTGAANTTAATACTCATCGNCCTAAAAGTCGTACTAAGTCTGGCGACAATTAATATGGATTAGAGGGAGTAGTATTTCTACATCAGGCC
TAATAAGGTTAATACTCATCGCCCTCCTGCAACAACTTTTTTTGATGCTCACAGTACTCCCTCATATCGTCTGCAAACTGGGCGTCACTCCTAAAATCAA
ACATTAAATCCACGTCCAGCATCCCGTCCGTGTGCTCGGTTCCATCGGGGGTAATATCATGATCACACTCNAGAAAGTCTACTGAATCTGGATACACAAT
CTTCCTCGCGGTTCCCTTTCCATAGTAGCAACGGCCAGTATGTATCAGGGGTAGAGGGCAGCAGAAATCTGGTTTTGCCTGCTCACCAGGACACGACCAA
TTGAGTTCAGCGAAGAAGAGTTTGTTACCAGCAGTCCTTGATTTGGAAGCAGCCACAAAATTAACGTGGTAGCACTCCCTGTCTAAGGACTCGGAACCAG
CCACCATACCACAGATAACAGTTAGCNCATATTTTGGTTC
page-top