Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhhg8n05
Contig Information
Length 753 bp
Tissue Anther at meiosis of MT4B CS wheat
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhhg8n05   
Homology (BLAST) Top Hit Os02g0250400 [Oryza sativa (japonica cultivar-group)] >gi|113535975|dbj|BAF08358.1| Os02g0250400 [Oryza sativa (japonica cultivar-group)]
Score 768
Evalue 4.0931e-87
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>rwhhg8n05
CATTTTACATTTATACCACCTCACAGATAAAACAAATCATGCTTTTGGTATCCCCTATTTCACCTTTGTACCCCACTTGCAATGAATTCAATCAAATGAA
AATATACAGGTATGAACCATTGGGACTATATGGAAGAACTACTTTCCCTTCTCCAGTTTAGTGTGCTATTCTCAGACGCTCTACAGGTGCAACAGCAGAG
GTGGAATGCTCACGAGGACTGAACAATCGGTTGGTCTGCGAAAGGGCCATATAGCCAACCCCTGGCGATATGACCATAAGCAGCCTCCGTCAAGTGAATA
CCGTCCCAGCTCCAGTGGGTCGTTGGGTCAGCACAGGCAGTGGCACCAGGCTCCCCGCATTTGGCTGTCACGTTGAAGTTGTAAGCGGCTTTGGCAACGG
ACCCAGGAGCCCCACAGCATGCCCTAGGTAACTGCTTGTAGAATCCAAACTTCTCAGGCTGGAGCATGAACTGGACAACCGGCGTGTAGTAGTCGCCGTA
TATGATCCGCACATTGGGGTGCTTGGGCCGGAGCTTCTCGAGTGCTCTCTTGAGGTGTGCGTTGTGCACCCATGAGAAGGTGTTGTACTGACGGATGCAC
CCGCTCCGGGCGCCATACTCGTGGGCTGGCATGTCGAGCATGTTCAGGTACACGGGGNAAGCACCCCAGTTGGCATCACCCCTGGCACGATGAGATCCAC
TGCCCCCTCGGCGATCAATTCCTCGACGCCATCGGAGATGCCCCTGGATGACA
page-top