Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whhg2b13
Contig Information
Length 777 bp
Tissue Anther at meiosis of MT4B CS wheat
Clones 1 Clones [Download: CSV  ,  FASTA ]
whhg2b13   
Homology (BLAST) Top Hit hypothetical protein OsI_09155 [Oryza sativa Indica Group]
Score 1217
Evalue 7.12762e-132
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>whhg2b13
TTTCTCCCGTGGATGATGAAGGGAACTTCACTGCCGAAGCTGGACAATTTAGTGGCTTATCTGTCCTGGGAGCTGGTAATGCTGCAGTTGTGAAGTATCT
GGACGAACATGTTTCACTCATCTTAGAAGAGCCTTACAAACACAAGTACCCCTATGATTGGAGATCGAAAGAACCAACCATATTCCGAGCAACTGAGCAG
TGGTTTGCCTCTGTGGATGGTTTTCGGGATGCTGCACTGGATGCAATCAAGAGAGTAACCTGGGTTCCTTCTCAGGGTGAAAACAGGATTGTTAACATGA
TCTCTGGCCGTTCTGACTGGTGTATTTCCCGGCAGAGAACATGGGGAGTTCCCATTCCTGTTTTTTATCATGTAGACACACAAGAACCTCTTATAACTGA
AGAAACGATTGAACATATCAAGGCTATAGTGTCAGACAAAGGCAGTGATGCCTGGTGGTATATGAAAACCGAGGAACTTCTTCCAGATAAATATCGCGAC
AAAGCATCTGAGTATCGTAAGGGCACTGATACAATGGATGTTTGGTTTGACTCTGGCTCCTCATGGGCTGCTGTTTCAGCAAAACGGGATGGCCTTAATT
TCCCTGCAGATGTATACCTTGAAGGTTCAGACCAACATCGTGGATGGTTTCANAGTTCNCTGTTAACCANCATCNCTACTACANGAAAGGCTCCATATTC
CAGTGTTATTACCCACGGNTTTGTATTGNACAAAGACGGTTTAAAAATGANCAAATCTGNTGGNAATGTCNNGGATC
page-top