Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whhg2c03
Contig Information
Length 754 bp
Tissue Anther at meiosis of MT4B CS wheat
Clones 1 Clones [Download: CSV  ,  FASTA ]
whhg2c03   
Homology (BLAST) Top Hit hypothetical protein OsI_26550 [Oryza sativa Indica Group] (no hit)
Score 458
Evalue 4.47263e-44
Total Hit Count 0
Registered year 2003
Contig Sequence     [ Download ]
>whhg2c03
ATATCGTATTCGAACCGTATATATACCCTTTAGCTTCTTTGAGAACTAAATATGCGCTTTGGGGCTCCTTTGGACACAAAGAAATTTCTGCAGACTGAAA
CTGTAGTAGGACTTGGTCAGTGCATGCCAAGTCTCTCCTTGACAGATACGCTATGCTCCGAACTGCTGTTCAAGTTCGGGCTAGTTGAATACTAGGTTCA
GATGATAATGAAGTGTTGGCAGCAAAGAACCAAGGGTTGGTTCTCAGTCAAGTCTGTTTGATTGATGCAGCGAAAAATATGTGGTGATGCTTCAGCAACA
ACGACCGGACAGTTGGTTCTCAGTCAAGTCTGTCTCATAGAAAGATACATGGTGATGGTCCGCCAACAAAGATCCAAGAGTTAGTCAGATCTGTGTGGCG
ATGGCTCGTCAACAATGGCCCAAGAGATCTAGTGTTGTACCTGCCATTAGGAACCAGTCATGTCTATGTGATAAAGCAACAAAAGTTGCAACCCGATACA
ACGGATGGGGTGCATGGAATCGATCCAATTCTAGTGAGTGGAGCACTGGCCATTTTCTGTGGTAAAACGTTTTACTATTGACCAGCAAGGTTGACTTTGC
TAACCAGTGTTCATTCCTGAGGATACAAGTCCCCCTAGTCCCAAATCGATCCCTCCTTTTTTGACCANGAACCATGACTTTGATAACCAACAATGACCAT
GGAGGCAGGGGCANAGCATAAAAGGAGTTTGCAGAGACATGAACTATTCAACTT
page-top