Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhhg8o17
Contig Information
Length 731 bp
Tissue Anther at meiosis of MT4B CS wheat
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhhg8o17   
Homology (BLAST) Top Hit Os02g0700000 [Oryza sativa (japonica cultivar-group)] >gi|41052667|dbj|BAD07514.1| unknown protein [Oryza sativa Japonica Group] >gi|41052975|dbj|BAD07885.1| unknown protein [Oryza sativa Japonica Group] >gi|113537367|dbj|BAF09750.1| Os02g0700000 [Oryza sativa (japonica cultivar-group)] >gi|125583363|gb|EAZ24294.1| hypothetical protein OsJ_007777 [Oryza sativa (japonica cultivar-group)] >gi|215713594|dbj|BAG94731.1| unnamed protein product [Oryza sativa Japonica Group]
Score 254
Evalue 9.45461e-25
Total Hit Count 15
Registered year 2003
Contig Sequence     [ Download ]
>rwhhg8o17
CATTGAGGACTTATACATGACATCAGGAAATATATGGCCTATTGACTACATGACGATACAGAAGTTTATATAAATAGACATCCTAAAATGCTGAAGTTAG
TACTTTACAGGAGACACTGCCAAAAGCCATGGTTACCAACGCTAGTTGCGCCCTTCTAAAGGATGCTCCCCCTTAGTGGAGGTCGCTGGCTGAACTGTTG
TCCGAGAACTGAGAAGCACTCGTGTTGAGAGCCTAATTGATCTCAACCTCCAGTTAGAAGTATATAACCGTTACCAATCTTTACATGTTGATGTTGTCAT
TACCGTTGAAGAGCGCAGCTATCCCTGAGTTATCCAGATGATGCAGCCCAAATGATTGAATAGCTTGACTCTTCAATTTACATAAATGTACACGGAACTT
GCAGGACACAGATACCAACCATACTTGGCATTTCAGTTGATTCCTATGTTGGATCTCGTGCCTCAGGACTAACCATTCTCACACGGCGAGCAGCAGCTAG
AGGTGGCCTGCCAACTGCTTCCAGTATCCTTGTGAACACAACCTTTGCGGGGACGCATGTAACTGGTGGAATTGCTCCGTCTGGTTTGATCAAGTCACTG
AAAATGCCACTGTGCGTACGCGGCTTTGCTTGAGTGCCACCTCCATGATGCCTTCTTCCAGTGGGGAATGGAAGAGAGGGTTCTGACCTTCTGGCTTGAC
AGACTTGCCTTCTTGGATGGGCTTCTTTTGA
page-top