Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whhg2b08
Contig Information
Length 775 bp
Tissue Anther at meiosis of MT4B CS wheat
Clones 1 Clones [Download: CSV  ,  FASTA ]
whhg2b08   
Homology (BLAST) Top Hit hypothetical protein OsI_05805 [Oryza sativa Indica Group]
Score 1251
Evalue 8.07159e-136
Total Hit Count 59
Registered year 2003
Contig Sequence     [ Download ]
>whhg2b08
AAGAGTGGTTGCCTGATGGTTGGCTTTGTTTGGTATGTGGTGCATCTGATACTCAAGAGCTTCCTCCAAATTATGTCAAGCTCGCAAAGGATGCGTACAC
ACCTGATTTAATGGCAGCATCTGACTGCATGCTTGGGAAAATTGGATATGGTACCGTGAGTGAGGCTTTGGCGTACAAGCTGCCATTTGTATTTGTTCGT
AGAGATTATTTCAATGAAGAGCCTTTTCTGCGGAATATGCTTGAGCATTATCAATGTGGCATTGAGATGATACGGAGGGATTTACTTACTGGACATTGGA
AACCTTATCTGCTACGCGCTTTAACACTTAAGCCCTGCTATGATCGTCCAATAAATGGTGGCGAGGTGGCTGCACATATCCTCCAGGATACTGCTGTCGG
GAAGAAGTATATTTCCGGCAAGTTGAGTGGGGCAAGACGATTACGTGATGCCATAGTGCTAGGATACCAACTACAGAGGGCTCCCGGGAGAGATGTAGGA
ATCCCTGAATGGTATTCTCTCTCCGAGAAAGAAATCGGTGTTCGCCCAGCACCCGCGTCTCGTCGGATTAATGGAAGTGCAGAATCATCTTTTGAGGACT
TCGAGATTCTCCATGGAGACATGCAAGGATTAACCGATACTATGGCTTTCCTGACAAGTTTATCTGGGCTTGTTGGAAACGATCCGAGGATCCCTGANAA
GCAATCCCGAGAAAGGACTGCTGCTTCTGTACTCTTTGACTTGGAGGAGGATATATATGTTGCAANACCACCTGG
page-top