Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhgc12h24
Contig Information
Length 340 bp
Tissue Anther at meiosis of DT4B CS wheat
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhgc12h24   
Homology (BLAST) Top Hit ribosomal protein [Bromus inermis]
Score 330
Evalue 1.60242e-29
Total Hit Count 360
Registered year 2003
Contig Sequence     [ Download ]
>rwhgc12h24
TGGGCNTAGCTGGTTCCAGTGGTCTACCGTATCCGTGTCAGGCGTGGTGGCAGGAAGAGGCCAGTGCCCAAGGGTATTGTCTATGGTAAGCCCAAGCACC
AGGGTATTACCCAGCTCAAGTTCCAGAGGAACAAGAGGTCTGTTGCTGAAGAAAGAGCTGGGCGCAGGCTGGGTGGTCTTCGTGTGCTCAACTCCTACTG
GGTGAATGAGGACTCTACCTACNAGTACTTTGAGGTCATCCTTGTTGATGTTGCTCACANTGCTGTCCNCAACNACCCAAGGATCAACTGGCTCTGCAAN
CCCGTGCACAANCACCGTGAGCTTCNCGGACTCACNTCNG
page-top