Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhgc10b07
Contig Information
Length 777 bp
Tissue Anther at meiosis of DT4B CS wheat
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhgc10b07   
Homology (BLAST) Top Hit unknown [Zea mays]
Score 650
Evalue 3.9843e-66
Total Hit Count 229
Registered year 2003
Contig Sequence     [ Download ]
>rwhgc10b07
TTAAGTTCAAACCTGAATTTAATTTCCATTTGACTGCAATCCTCGGTATTATATGTTCTGTCTCTACAAAGAAGAAACGCAGTCCACAAAGGACACAGAC
CTTATTGAGCTTAGGGAAAAACAATGTATATAGTTCTCTTCTAATTGCATAAATATAGTCTTCTCTCTCTCACTAGTTTTCATATATAAGCTCTCGACTG
AGTTCCGCTCGGTGTCCAAAACTTTCATATCTAAACCATGACTGCGCCAGTGCCTTCTCTCATCTACCGACGCGGCGGGGGTCTCCTCCCGCCTGGAGCT
TGATCTTCCTCGTCGGATTCGACGTCTCCATACTGCCACAGCCGCAGCCTTTCCTTCTTCGCCTTCTCCTGGAACTGTTCCAGGTTCTCGAGAGCTGTCT
TCCTCTCCTTGGTGTCCCATCTCTTGCCCCTTTCAAGTCGGGCAAGCCCTTCCTCGAGCATGGCAGCATTGATGCTGGATTCTGTCTCTGGATCAACAAG
AGTCACAATGAGTACAGGTCCAGTGCCTTGTCCCTTCACTTTACCACCAGTAGTGTCGCGCTCTTCGATCATTGCCCGGTATTGTTTTGAACTGCTCAGC
AAGCATTCGCTGAGATACTCTGCTGCTTCCTGACCATTATCATCCTCCAGACCAGGCACCTTTATGAAGGCAAGGCTGCAGAGCTGAGCAAGAGGAGGAG
AGGAGGATACTGATGGGTCTGCAGGCCGGATGCGGTTGTAAGGAACCACTTCTTGGTTGCCAAAATCAATGTAGAAT
page-top